shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(C5orf13-shRNA-Seq2)(CAT#: AdV-SI0958WQ)
This product is a C5orf13-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. The C5orf13 gene may have roles in neural function and cellular differentiation. The expression of C5orf13-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Adenoviridae |
| Species | Adenovirus |
| Serotype | HAdV-5 |
| Backbone | AdV-5 (ΔE1/E3) |
| Tropism | Both nondividing and dividing cells |
| Insert | C5orf13-shRNA-Seq2 |
| Related Target/Protein | C5orf13 |
| Region | CDS |
| TargetSeq | CAAGAACCATTTCCAAACAAG |
| NCBI RefSeq | NM_004772 |
| Alternative Names | P311; PTZ17; SEZ17; D4S114; NREP; PRO1873 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Breast Cancer |