shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(C7orf64-shRNA-Seq3)(CAT#: AdV-SI0826WQ)
This product is a C7orf64-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. The expression of C7orf64-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Adenoviridae |
| Species | Adenovirus |
| Serotype | HAdV-5 |
| Backbone | AdV-5 (ΔE1/E3) |
| Tropism | Both nondividing and dividing cells |
| Insert | C7orf64-shRNA-Seq3 |
| Related Target/Protein | C7orf64 |
| Region | CDS |
| TargetSeq | CCACAATGACTCTTTGCGGAA |
| NCBI RefSeq | NM_032120 |
| Alternative Names | RBM48; HSPC304 |
| Titer | >1*10^10 GC/mL |