shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(C7orf64-shRNA-Seq4)(CAT#: AdV-SI0827WQ)
This product is a C7orf64-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. The expression of C7orf64-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Adenoviridae |
Species | Adenovirus |
Serotype | HAdV-5 |
Backbone | AdV-5 (ΔE1/E3) |
Tropism | Both nondividing and dividing cells |
Insert | C7orf64-shRNA-Seq4 |
Related Target/Protein | C7orf64 |
Region | CDS |
TargetSeq | GAAGGAATTAGTTGAGCGATT |
NCBI RefSeq | NM_032120 |
Alternative Names | RBM48; HSPC304 |
Titer | >1*10^10 GC/mL |