shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(C9orf23-shRNA-Seq3)(CAT#: AdV-SI0820WQ)

This product is a C9orf23-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. The C9orf23 gene encodes a protein that appears to belong to a family of evolutionarily related proteins (DUF78), that may share one or more domains in common. The expression of C9orf23-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype HAdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Insert C9orf23-shRNA-Seq3
Related Target/Protein C9orf23
Region CDS
TargetSeq CCAAGCTACGTTTCCTTCAGA
NCBI RefSeq NM_148178
Alternative Names RPP25L; bA296L22.5
Titer >1*10^10 GC/mL
Target Gene
Gene ID 138716
Uniprot ID Q8N5L8

Related Products