shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(CCDC11-shRNA-Seq2)(CAT#: AdV-SI0984WQ)
This product is a CCDC11-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. The CCDC11 gene belongs to the CFAP53 family. It was found to be differentially expressed by the ciliated cells of frog epidermis and in skin fibroblasts from human. The expression of CCDC11-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Adenoviridae |
| Species | Adenovirus |
| Serotype | HAdV-5 |
| Backbone | AdV-5 (ΔE1/E3) |
| Tropism | Both nondividing and dividing cells |
| Insert | CCDC11-shRNA-Seq2 |
| Related Target/Protein | CCDC11 |
| Region | CDS |
| TargetSeq | CGAACAGGACTTGAACATGAA |
| NCBI RefSeq | NM_145020 |
| Alternative Names | HTX6; CFAP53 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Visceral heterotaxy-6 |