shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(Ccdc43-shRNA-Seq1)(CAT#: AdV-SI3060WQ)

This product is a Ccdc43-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The expression of Ccdc43-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype AdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Modification ΔE1/E3
Insert Ccdc43-shRNA-Seq1
Related Target/Protein Ccdc43
Region CDS
TargetSeq CATCGCCACCTTGATTGAGAA
NCBI RefSeq NM_025918
Titer >1*10^10 GC/mL
Target Gene
Gene ID 124808
Uniprot ID Q96MW1

Related Products