shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(CLMP-shRNA-Seq3)(CAT#: AdV-SI0600WQ)

This product is a CLMP-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. The CLMP gene encodes a type I transmembrane protein that is localized to junctional complexes between endothelial and epithelial cells and may have a role in cell-cell adhesion. The expression of CLMP-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype HAdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Insert CLMP-shRNA-Seq3
Related Target/Protein CLMP
Region CDS
TargetSeq CCTTGCAGATTGAACCTCTGA
NCBI RefSeq NM_024769
Alternative Names ACAM; ASAM; CSBM; CSBS
Titer >1*10^10 GC/mL
Related Diseases Congenital short bowel syndrome
Target Gene
Gene ID 79827
Uniprot ID Q9H6B4

Related Products