shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(COQ9-shRNA-Seq3)(CAT#: AdV-SI0622WQ)
This product is a COQ9-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. The COQ9 gene encoded protein is likely necessary for biosynthesis of coenzyme Q10, as mutations at this locus have been associated with autosomal-recessive neonatal-onset primary coenzyme Q10 deficiency. The expression of COQ9-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Adenoviridae |
| Species | Adenovirus |
| Serotype | HAdV-5 |
| Backbone | AdV-5 (ΔE1/E3) |
| Tropism | Both nondividing and dividing cells |
| Insert | COQ9-shRNA-Seq3 |
| Related Target/Protein | COQ9 |
| Region | CDS |
| TargetSeq | GCTAAGGTCTTCAGATGAGCA |
| NCBI RefSeq | NM_020312 |
| Alternative Names | COQ10D5; C16orf49; HSPC326; PSEC0129 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Autosomal-recessive neonatal-onset primary coenzyme Q10 deficiency |