shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(Csn1s1-shRNA-Seq1)(CAT#: AdV-SI3146WQ)

This product is a Csn1s1-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The protein encoded by Csn1s1 gene may play an important role in the capacity of milk to transport calcium phosphate. The expression of Csn1s1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype AdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Modification ΔE1/E3
Insert Csn1s1-shRNA-Seq1
Related Target/Protein Csn1s1
Region CDS
TargetSeq CCCACAAATCTTCCAGTATGA
NCBI RefSeq NM_007784
Alternative Names CASA; CSN1
Titer >1*10^10 GC/mL
Target Gene
Gene ID 1446
Uniprot ID P47710

Related Products