shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(Csrnp1-shRNA-Seq2)(CAT#: AdV-SI2615WQ)
This product is a Csrnp1-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The Csrnp1 gene encodes a protein that localizes to the nucleus and expression of this gene is induced in response to elevated levels of axin. The expression of Csrnp1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Adenoviridae |
| Species | Adenovirus |
| Serotype | AdV-5 |
| Backbone | AdV-5 (ΔE1/E3) |
| Tropism | Both nondividing and dividing cells |
| Modification | ΔE1/E3 |
| Insert | Csrnp1-shRNA-Seq2 |
| Related Target/Protein | Csrnp1 |
| Region | CDS |
| TargetSeq | CCTGAATTTCAGTGACTCTGA |
| NCBI RefSeq | NM_153287 |
| Alternative Names | AXUD1; URAX1; TAIP-3; CSRNP-1; FAM130B |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Cancer |
