shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(CTTNBP2NL-shRNA-Seq2)(CAT#: AdV-SI0795WQ)

This product is a CTTNBP2NL-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. The expression of CTTNBP2NL-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype HAdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Insert CTTNBP2NL-shRNA-Seq2
Related Target/Protein CTTNBP2NL
Region CDS
TargetSeq GACCTTGTTATAGAAGCCTTA
NCBI RefSeq NM_018704
Alternative Names KIAA1433
Titer >1*10^10 GC/mL
Target Gene
Gene ID 55917
Uniprot ID Q9P2B4

Related Products