shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(Cyb5d2-shRNA-Seq5)(CAT#: AdV-SI2890WQ)
This product is a Cyb5d2-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The Cyb5d2 gene encodes a heme-binding protein which promotes neuronal but not astrocyte differentiation. The expression of Cyb5d2-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Adenoviridae |
| Species | Adenovirus |
| Serotype | AdV-5 |
| Backbone | AdV-5 (ΔE1/E3) |
| Tropism | Both nondividing and dividing cells |
| Modification | ΔE1/E3 |
| Insert | Cyb5d2-shRNA-Seq5 |
| Related Target/Protein | Cyb5d2 |
| Region | CDS |
| TargetSeq | GCTTCGCAGAAAGCAATACTT |
| NCBI RefSeq | XM_109819 |
| Alternative Names | CYB5D2 |
| Titer | >1*10^10 GC/mL |
