shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(Cyb5d2-shRNA-Seq7)(CAT#: AdV-SI2892WQ)

This product is a Cyb5d2-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The Cyb5d2 gene encodes a heme-binding protein which promotes neuronal but not astrocyte differentiation. The expression of Cyb5d2-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype AdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Modification ΔE1/E3
Insert Cyb5d2-shRNA-Seq7
Related Target/Protein Cyb5d2
Region 3UTR
TargetSeq CAGCTTTCTTTACTCATATTG
NCBI RefSeq NM_001024926
Alternative Names CYB5D2
Titer >1*10^10 GC/mL
Target Gene
Gene ID 124936
Uniprot ID Q8WUJ1

Related Products