shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(DDX3X-shRNA-Seq1)(CAT#: AdV-SI0502WQ)

This product is a DDX3X-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. The protein encoded by DDX3X has ATP-dependent RNA helicase activity and display a high level of RNA-independent ATPase activity. Misregulation of this gene has been implicated in tumorigenesis and alternative splicing results in multiple transcript variants. The expression of DDX3X-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype HAdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Insert DDX3X-shRNA-Seq1
Related Target/Protein DDX3X
Region 3UTR
TargetSeq CCCTGCCAAACAAGCTAATAT
NCBI RefSeq NM_001356
Alternative Names DBX; DDX3; HLP2; DDX14; CAP-Rf; MRX102
Titer >1*10^10 GC/mL
Related Diseases X-linked recessive inheritance
Target Gene
Gene ID 1654
Uniprot ID O00571

Related Products