shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(Defb41-shRNA-Seq1)(CAT#: AdV-SI3058WQ)
This product is a Defb41-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The protein encoded by OR8D4 gene has bactericidal activity and may play a role in the antimicrobial protection of sperm and urogenital tract epithelia. The expression of Defb41-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Adenoviridae |
| Species | Adenovirus |
| Serotype | AdV-5 |
| Backbone | AdV-5 (ΔE1/E3) |
| Tropism | Both nondividing and dividing cells |
| Modification | ΔE1/E3 |
| Insert | Defb41-shRNA-Seq1 |
| Related Target/Protein | Defb41 |
| Region | CDS |
| TargetSeq | CTGTATCAGATGGAGGAACCA |
| NCBI RefSeq | NM_183124 |
| Alternative Names | BD-17; Bd-41; Defb16; Defb17; Gm15386; 9230102D03Rik |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Antimicrobial protection |