shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(Defb41-shRNA-Seq1)(CAT#: AdV-SI3058WQ)
This product is a Defb41-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The protein encoded by OR8D4 gene has bactericidal activity and may play a role in the antimicrobial protection of sperm and urogenital tract epithelia. The expression of Defb41-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Adenoviridae |
Species | Adenovirus |
Serotype | AdV-5 |
Backbone | AdV-5 (ΔE1/E3) |
Tropism | Both nondividing and dividing cells |
Modification | ΔE1/E3 |
Insert | Defb41-shRNA-Seq1 |
Related Target/Protein | Defb41 |
Region | CDS |
TargetSeq | CTGTATCAGATGGAGGAACCA |
NCBI RefSeq | NM_183124 |
Alternative Names | BD-17; Bd-41; Defb16; Defb17; Gm15386; 9230102D03Rik |
Titer | >1*10^10 GC/mL |
Related Diseases | Antimicrobial protection |