shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(DEPDC1-shRNA-Seq2)(CAT#: AdV-SI0566WQ)

This product is a DEPDC1-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. The DEPDC1 gene may be involved in transcriptional regulation as a transcriptional corepressor. The expression of DEPDC1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype HAdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Insert DEPDC1-shRNA-Seq2
Related Target/Protein DEPDC1
Region 3UTR
TargetSeq GCTGCCAAATGTTGCACTCTT
NCBI RefSeq NM_017779
Alternative Names DEP.8; SDP35; DEPDC1A; DEPDC1-V2
Titer >1*10^10 GC/mL
Related Diseases Bladder cancer
Target Gene
Gene ID 55635
Uniprot ID Q5TB30

Related Products