shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(DHX8-shRNA-Seq1)(CAT#: AdV-SI0526WQ)

This product is a DHX8-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. The protein encoded by DHX8 gene contains the DEAH (Asp-Glu-Ala-His) motif which is characteristic of all DEAH box proteins, and is thought to function as an ATP-dependent RNA helicase that regulates the release of spliced mRNAs from spliceosomes prior to their export from the nucleus.The expression of DHX8-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype HAdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Insert DHX8-shRNA-Seq1
Related Target/Protein DHX8
Region CDS
TargetSeq GACCCAACTAAGCTAAGCAAA
NCBI RefSeq NM_004941
Alternative Names DDX8; Dhr2; HRH1; PRP22; PRPF22
Titer >1*10^10 GC/mL
Related Diseases HIV infection
Target Gene
Gene ID 1659
Uniprot ID Q14562

Related Products