shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(ENSMUSG00000063277-shRNA-Seq9)(CAT#: AdV-SI3053WQ)

This product is a ENSMUSG00000063277-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The expression of ENSMUSG00000063277-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype AdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Modification ΔE1/E3
Insert ENSMUSG00000063277-shRNA-Seq9
Related Target/Protein ENSMUSG00000063277
Region CDS
TargetSeq CCAGTCCATAATTGGTTCCAT
NCBI RefSeq NM_025940
Alternative Names Gm10128
Titer >1*10^10 GC/mL
Target Gene
Gene ID 100042312
Uniprot ID K7N708

Related Products