shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(EWSR1-shRNA-Seq1)(CAT#: AdV-SI0535WQ)

This product is a EWSR1-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. The EWSR1 gene encodes a multifunctional protein that is involved in various cellular processes, including gene expression, cell signaling, and RNA processing and transport. The expression of EWSR1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype HAdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Insert EWSR1-shRNA-Seq1
Related Target/Protein EWSR1
Region 3UTR
TargetSeq TGCATTGACTACCAGATTTAT
NCBI RefSeq NM_005243
Alternative Names EWS; EWS-FLI1; bK984G1.4
Titer >1*10^10 GC/mL
Related Diseases Ewing sarcoma as well as neuroectodermal tumors
Target Gene
Gene ID 2130
Uniprot ID Q01844

Related Products