shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(FANCI-shRNA-Seq2)(CAT#: AdV-SI0840WQ)
This product is a FANCI-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. The FANCI gene encodes the protein for complementation group I. Alternative splicing results in two transcript variants encoding different isoforms. The expression of FANCI-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Adenoviridae |
Species | Adenovirus |
Serotype | HAdV-5 |
Backbone | AdV-5 (ΔE1/E3) |
Tropism | Both nondividing and dividing cells |
Insert | FANCI-shRNA-Seq2 |
Related Target/Protein | FANCI |
Region | CDS |
TargetSeq | CCATTACAATTCTGTCGCCAA |
NCBI RefSeq | NM_018193 |
Alternative Names | KIAA1794 |
Titer | >1*10^10 GC/mL |
Related Diseases | DNA Damage |