shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(Gpatch2-shRNA-Seq2)(CAT#: AdV-SI2676WQ)

This product is a Gpatch2-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The Gpatch2 gene encodes a nuclear factor that may play a role in spermatogenesis and in tumor growth during breast cancer. Mutations in this gene cause Joubert syndrome (JBTS). The expression of Gpatch2-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype AdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Modification ΔE1/E3
Insert Gpatch2-shRNA-Seq2
Related Target/Protein Gpatch2
Region CDS
TargetSeq GCTGGCATTTCAGTCGAACAA
NCBI RefSeq NM_026367
Alternative Names Pfa1; CT110; GPATC2; PPP1R30
Titer >1*10^10 GC/mL
Related Diseases Breast cancer
Target Gene
Gene ID 55105
Uniprot ID Q9NW75

Related Products