shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(HSPA13-shRNA-Seq1)(CAT#: AdV-SI0862WQ)
This product is a HSPA13-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. The protein encoded by HSPA13 gene is a member of the heat shock protein 70 family and is found associated with microsomes. Members of this protein family play a role in the processing of cytosolic and secretory proteins, as well as in the removal of denatured or incorrectly-folded proteins. The expression of HSPA13-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Adenoviridae |
| Species | Adenovirus |
| Serotype | HAdV-5 |
| Backbone | AdV-5 (ΔE1/E3) |
| Tropism | Both nondividing and dividing cells |
| Insert | HSPA13-shRNA-Seq1 |
| Related Target/Protein | HSPA13 |
| Region | CDS |
| TargetSeq | CCTAAAGTGATTGGTATTGAT |
| NCBI RefSeq | NM_006948 |
| Alternative Names | STCH |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Oral Cancer |