shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(KHDRBS1-shRNA-Seq1)(CAT#: AdV-SI0545WQ)
This product is a KHDRBS1-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted.The KHDRBS1 encoded protein appears to have many functions and may be involved in a variety of cellular processes, including alternative splicing, cell cycle regulation, RNA 3'-end formation, tumorigenesis, and regulation of human immunodeficiency virus gene expression. The expression of KHDRBS1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Adenoviridae |
| Species | Adenovirus |
| Serotype | HAdV-5 |
| Backbone | AdV-5 (ΔE1/E3) |
| Tropism | Both nondividing and dividing cells |
| Insert | KHDRBS1-shRNA-Seq1 |
| Related Target/Protein | KHDRBS1 |
| Region | 3UTR |
| TargetSeq | GTTCCCAAGTTAGTCAAGTAT |
| NCBI RefSeq | NM_006559 |
| Alternative Names | p62; p68; Sam68 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Primary ovarian insufficiency |