shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(KIAA1919-shRNA-Seq1)(CAT#: AdV-SI0672WQ)
This product is a KIAA1919-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. The KIAA1919 gene may function as a sodium-dependent glucose transporter is potential channel for urea in the inner medulla of kidney. The expression of KIAA1919-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Adenoviridae |
| Species | Adenovirus |
| Serotype | HAdV-5 |
| Backbone | AdV-5 (ΔE1/E3) |
| Tropism | Both nondividing and dividing cells |
| Insert | KIAA1919-shRNA-Seq1 |
| Related Target/Protein | KIAA1919 |
| Region | CDS |
| TargetSeq | GCAGGCCTTACACTTCTCTTT |
| NCBI RefSeq | NM_153369 |
| Alternative Names | NaGLT1; MFSD4B |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Renal carcinoma |
