shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(Ktn1-shRNA-Seq5)(CAT#: AdV-SI2599WQ)

This product is a Ktn1-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The Ktn1 gene encodes an integral membrane protein that is a member of the kinectin protein family. The expression of Ktn1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype AdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Modification ΔE1/E3
Insert Ktn1-shRNA-Seq5
Related Target/Protein Ktn1
Region CDS
TargetSeq GCAGAAACTTCCAGTAGTGTT
NCBI RefSeq NM_008477
Alternative Names CG1; KNT; MU-RMS-40.19
Titer >1*10^10 GC/mL
Target Gene
Gene ID 3895
Uniprot ID Q86UP2

Related Products