shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(LOC286238-shRNA-Seq1)(CAT#: AdV-SI0582WQ)
This product is a LOC286238-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. LOC286238 is an RNA Gene, and is affiliated with the ncRNA class. The expression of LOC286238-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Adenoviridae |
Species | Adenovirus |
Serotype | HAdV-5 |
Backbone | AdV-5 (ΔE1/E3) |
Tropism | Both nondividing and dividing cells |
Insert | LOC286238-shRNA-Seq1 |
Related Target/Protein | LOC286238 |
Region | CDS |
TargetSeq | CAGCAAGGAATAGCAGTGAAA |
NCBI RefSeq | XM_379684 |
Titer | >1*10^10 GC/mL |
Related Diseases | Cardiovascular disease (CVD) |