shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(Lsm14a-shRNA-Seq1)(CAT#: AdV-SI2628WQ)
This product is a Lsm14a-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The Lsm14a gene encodes Sm-like proteins that are thought to form a stable heteromer present in tri-snRNP particles, which are important for pre-mRNA splicing. The expression of Lsm14a-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Adenoviridae |
| Species | Adenovirus |
| Serotype | AdV-5 |
| Backbone | AdV-5 (ΔE1/E3) |
| Tropism | Both nondividing and dividing cells |
| Modification | ΔE1/E3 |
| Insert | Lsm14a-shRNA-Seq1 |
| Related Target/Protein | Lsm14a |
| Region | CDS |
| TargetSeq | CAACATCTCTTGTGATGATAA |
| NCBI RefSeq | NM_025948 |
| Alternative Names | RAP55; FAM61A; RAP55A; C19orf13 |
| Titer | >1*10^10 GC/mL |