shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(LY6G6D-shRNA-Seq2)(CAT#: AdV-SI0669WQ)
This product is a LY6G6D-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. LY6G6D belongs to a cluster of leukocyte antigen-6 (LY6) genes and most LY6 proteins are attached to the cell surface by a glycosylphosphatidylinositol (GPI) anchor that is directly involved in signal transduction. The expression of LY6G6D-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Adenoviridae |
| Species | Adenovirus |
| Serotype | HAdV-5 |
| Backbone | AdV-5 (ΔE1/E3) |
| Tropism | Both nondividing and dividing cells |
| Insert | LY6G6D-shRNA-Seq2 |
| Related Target/Protein | LY6G6D |
| Region | CDS |
| TargetSeq | GAGCCGAAGACCAAGAATCAT |
| NCBI RefSeq | NM_021246 |
| Alternative Names | G6D; NG25; LY6-D; MEGT1; C6orf23 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Colorectal cancer |