shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(Mepe-shRNA-Seq1)(CAT#: AdV-SI3154WQ)
This product is a Mepe-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The Mepe gene encodes a secreted calcium-binding phosphoprotein that belongs to the small integrin-binding ligand, N-linked glycoprotein (SIBLING) family of proteins. The expression of Mepe-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Adenoviridae |
| Species | Adenovirus |
| Serotype | AdV-5 |
| Backbone | AdV-5 (ΔE1/E3) |
| Tropism | Both nondividing and dividing cells |
| Modification | ΔE1/E3 |
| Insert | Mepe-shRNA-Seq1 |
| Related Target/Protein | Mepe |
| Region | CDS |
| TargetSeq | GCTCCAGCAAAGCTGAAGTTA |
| NCBI RefSeq | NM_053172 |
| Alternative Names | OF45 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Aging-related trabecular bone loss |