shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(Olfr1037-shRNA-Seq1)(CAT#: AdV-SI3107WQ)

This product is a Olfr1037-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The Olfr1037 gene encodes a olfactory receptor protein that interacts with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The expression of Olfr1037-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype AdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Modification ΔE1/E3
Insert Olfr1037-shRNA-Seq1
Related Target/Protein Olfr1037
Region CDS
TargetSeq CGACTTGTAATGGGCCCTTAT
NCBI RefSeq NM_001011532
Alternative Names MOR171-52; MOR256-34P
Titer >1*10^10 GC/mL
Related Diseases Olfactory dysfunction
Target Gene
Gene ID 259151
Uniprot ID Q7TR84

Related Products