shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(Olfr1532-ps1-shRNA-Seq4)(CAT#: AdV-SI2885WQ)

This product is a Olfr1532-ps1-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The Olfr1532-ps1 gene encodes a olfactory receptor protein that interacts with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The expression of Olfr1532-ps1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype AdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Modification ΔE1/E3
Insert Olfr1532-ps1-shRNA-Seq4
Related Target/Protein Olfr1532-ps1
Region CDS
TargetSeq CTCTTCTATGGCTCAGGAATA
NCBI RefSeq NM_001011542
Alternative Names Olfr708; MOR260-6P; MOR260-9P; GA_x6K02T2PBJ9-9297671-9298594
Titer >1*10^10 GC/mL
Related Diseases Olfactory dysfunction
Target Gene
Gene ID 258173
Uniprot ID A0A0R4J8U2

Related Products