shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(Osgin1-shRNA-Seq1)(CAT#: AdV-SI3153WQ)

This product is a Osgin1-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The Osgin1 gene encodes an oxidative stress response protein that regulates cell death. The expression of Osgin1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype AdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Modification ΔE1/E3
Insert Osgin1-shRNA-Seq1
Related Target/Protein Osgin1
Region CDS
TargetSeq GACTTGGTCATAGACCCAGAT
NCBI RefSeq NM_027950
Alternative Names BDGI; OKL38
Titer >1*10^10 GC/mL
Related Diseases Inflammatory
Target Gene
Gene ID 29948
Uniprot ID Q9UJX0

Related Products