shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(PCMTD1-shRNA-Seq2)(CAT#: AdV-SI0577WQ)
This product is a PCMTD1-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. PCMTD1 is a Protein Coding gene. Gene Ontology (GO) annotations related to this gene include protein-L-isoaspartate (D-aspartate) O-methyltransferase activity. The expression of PCMTD1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Adenoviridae |
Species | Adenovirus |
Serotype | HAdV-5 |
Backbone | AdV-5 (ΔE1/E3) |
Tropism | Both nondividing and dividing cells |
Insert | PCMTD1-shRNA-Seq2 |
Related Target/Protein | PCMTD1 |
Region | 3UTR |
TargetSeq | GCTCCAGTAATTCCACAACAT |
NCBI RefSeq | NM_052937 |
Titer | >1*10^10 GC/mL |
Related Diseases | Glaucoma, Lung cancer |