shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(PIGY-shRNA-Seq2)(CAT#: AdV-SI0569WQ)

This product is a PIGY-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. The protein encoded by PIGY gene, which is well-conserved, is encoded by the same bicistronic transcript that encodes phosphatidylinositol glycan anchor biosynthesis, class Y, but the two proteins are unrelated. The expression of PIGY-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype HAdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Insert PIGY-shRNA-Seq2
Related Target/Protein PIGY
Region CDS
TargetSeq GATGACACGTCAAAGTAAGAA
NCBI RefSeq NM_032906
Alternative Names PREY
Titer >1*10^10 GC/mL
Related Diseases Hyperphosphatasia and mental retardation syndrome
Target Gene
Gene ID 100996939
Uniprot ID Q96I23

Related Products