shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(PIGY-shRNA-Seq3)(CAT#: AdV-SI0570WQ)
This product is a PIGY-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. The protein encoded by PIGY gene, which is well-conserved, is encoded by the same bicistronic transcript that encodes phosphatidylinositol glycan anchor biosynthesis, class Y, but the two proteins are unrelated. The expression of PIGY-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Adenoviridae |
| Species | Adenovirus |
| Serotype | HAdV-5 |
| Backbone | AdV-5 (ΔE1/E3) |
| Tropism | Both nondividing and dividing cells |
| Insert | PIGY-shRNA-Seq3 |
| Related Target/Protein | PIGY |
| Region | CDS |
| TargetSeq | CCAATCATTGATGGGATCCCT |
| NCBI RefSeq | NM_032906 |
| Alternative Names | PREY |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Hyperphosphatasia and mental retardation syndrome |