shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(PIGY-shRNA-Seq3)(CAT#: AdV-SI0570WQ)
This product is a PIGY-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. The protein encoded by PIGY gene, which is well-conserved, is encoded by the same bicistronic transcript that encodes phosphatidylinositol glycan anchor biosynthesis, class Y, but the two proteins are unrelated. The expression of PIGY-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Adenoviridae |
Species | Adenovirus |
Serotype | HAdV-5 |
Backbone | AdV-5 (ΔE1/E3) |
Tropism | Both nondividing and dividing cells |
Insert | PIGY-shRNA-Seq3 |
Related Target/Protein | PIGY |
Region | CDS |
TargetSeq | CCAATCATTGATGGGATCCCT |
NCBI RefSeq | NM_032906 |
Alternative Names | PREY |
Titer | >1*10^10 GC/mL |
Related Diseases | Hyperphosphatasia and mental retardation syndrome |