shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(Poc5-shRNA-Seq1)(CAT#: AdV-SI2739WQ)

This product is a Poc5-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The protein encoded by Poc5 gene is essential for the assembly of the distal half of centrioles, required for centriole elongation. The expression of Poc5-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype AdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Modification ΔE1/E3
Insert Poc5-shRNA-Seq1
Related Target/Protein Poc5
Region CDS
TargetSeq CAACAGCAGTTTGGCGATAAT
NCBI RefSeq NM_026173
Alternative Names C5orf37
Titer >1*10^10 GC/mL
Target Gene
Gene ID 134359
Uniprot ID Q8NA72

Related Products