shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(Poc5-shRNA-Seq5)(CAT#: AdV-SI2743WQ)
This product is a Poc5-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The protein encoded by Poc5 gene is essential for the assembly of the distal half of centrioles, required for centriole elongation. The expression of Poc5-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Adenoviridae |
Species | Adenovirus |
Serotype | AdV-5 |
Backbone | AdV-5 (ΔE1/E3) |
Tropism | Both nondividing and dividing cells |
Modification | ΔE1/E3 |
Insert | Poc5-shRNA-Seq5 |
Related Target/Protein | Poc5 |
Region | CDS |
TargetSeq | GAAGACAATTACAGCCCGGAT |
NCBI RefSeq | NM_026173 |
Alternative Names | C5orf37 |
Titer | >1*10^10 GC/mL |