shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(Pramel1-shRNA-Seq1)(CAT#: AdV-SI3149WQ)

This product is a Pramel1-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The Pramel1 gene may play a role in acrosome development and also in sperm maturation and motility. The expression of Pramel1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype AdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Modification ΔE1/E3
Insert Pramel1-shRNA-Seq1
Related Target/Protein Pramel1
Region CDS
TargetSeq CTACAGGAGAATCTTAGAGAT
NCBI RefSeq NM_031377
Titer >1*10^10 GC/mL
Related Diseases Infertility
Target Gene
Gene ID 83491
Uniprot ID Q99MW3

Related Products