shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(PRDM15-shRNA-Seq1)(CAT#: AdV-SI0713WQ)

This product is a PRDM15-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. The PRDM15 gene plays a role as a molecular node in a transcriptional network regulating embryonic development and cell fate decision. The expression of PRDM15-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype HAdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Insert PRDM15-shRNA-Seq1
Related Target/Protein PRDM15
Region CDS
TargetSeq CGAGATACCTTTGAACGTGAA
NCBI RefSeq NM_022115
Alternative Names PFM15; ZNF298; C21orf83
Titer >1*10^10 GC/mL
Related Diseases Pancreatic cancer
Target Gene
Gene ID 63977
Uniprot ID P57071

Related Products