shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(PRPF18-shRNA-Seq2)(CAT#: AdV-SI0523WQ)
This product is a PRPF18-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. The protein encoded by PRPF18 gene is found to be essential for the catalytic step II in pre-mRNA splicing process. Mutations in this gene result in RNA synthesis dysfunction.The expression of PRPF18-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Adenoviridae |
| Species | Adenovirus |
| Serotype | HAdV-5 |
| Backbone | AdV-5 (ΔE1/E3) |
| Tropism | Both nondividing and dividing cells |
| Insert | PRPF18-shRNA-Seq2 |
| Related Target/Protein | PRPF18 |
| Region | CDS |
| TargetSeq | GAGGAGAACCAATCAGACTAT |
| NCBI RefSeq | NM_003675 |
| Alternative Names | PRP18; hPrp18 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | late-onset Alzheimer disease (LOAD) |