shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(S1pr4-shRNA-Seq1)(CAT#: AdV-SI3173WQ)
This product is a S1pr4-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The S1pr4 gene is a member of the endothelial differentiation, G-protein-coupled (EDG)) receptor gene family. The expression of S1pr4-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Adenoviridae |
Species | Adenovirus |
Serotype | AdV-5 |
Backbone | AdV-5 (ΔE1/E3) |
Tropism | Both nondividing and dividing cells |
Modification | ΔE1/E3 |
Insert | S1pr4-shRNA-Seq1 |
Related Target/Protein | S1pr4 |
Region | CDS |
TargetSeq | CTCATTGTCCTGCACTACAAT |
NCBI RefSeq | NM_010102 |
Alternative Names | EDG6; LPC1; S1P4; SLP4 |
Titer | >1*10^10 GC/mL |
Related Diseases | Lymphoma |