shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(S1pr4-shRNA-Seq1)(CAT#: AdV-SI3173WQ)
This product is a S1pr4-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The S1pr4 gene is a member of the endothelial differentiation, G-protein-coupled (EDG)) receptor gene family. The expression of S1pr4-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Adenoviridae |
| Species | Adenovirus |
| Serotype | AdV-5 |
| Backbone | AdV-5 (ΔE1/E3) |
| Tropism | Both nondividing and dividing cells |
| Modification | ΔE1/E3 |
| Insert | S1pr4-shRNA-Seq1 |
| Related Target/Protein | S1pr4 |
| Region | CDS |
| TargetSeq | CTCATTGTCCTGCACTACAAT |
| NCBI RefSeq | NM_010102 |
| Alternative Names | EDG6; LPC1; S1P4; SLP4 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Lymphoma |
