shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(Scap-shRNA-Seq1)(CAT#: AdV-SI3131WQ)
This product is a Scap-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The Scap gene encodes a protein with a sterol sensing domain (SSD) and seven WD domains. In the presence of cholesterol, this protein binds to sterol regulatory element binding proteins (SREBPs) and mediates their transport from the ER to the Golgi. The expression of Scap-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Adenoviridae |
| Species | Adenovirus |
| Serotype | AdV-5 |
| Backbone | AdV-5 (ΔE1/E3) |
| Tropism | Both nondividing and dividing cells |
| Modification | ΔE1/E3 |
| Insert | Scap-shRNA-Seq1 |
| Related Target/Protein | Scap |
| Region | CDS |
| TargetSeq | CATCCTGTTTGCCTACATCTA |
| NCBI RefSeq | NM_001001144 |
| Titer | >1*10^10 GC/mL |
