shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(SH3BP5-shRNA-Seq1)(CAT#: AdV-SI0937WQ)
This product is a SH3BP5-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. The SH3BP5 gene functions as guanine nucleotide exchange factor (GEF) with specificity for RAB11A and RAB25. The expression of SH3BP5-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Adenoviridae |
| Species | Adenovirus |
| Serotype | HAdV-5 |
| Backbone | AdV-5 (ΔE1/E3) |
| Tropism | Both nondividing and dividing cells |
| Insert | SH3BP5-shRNA-Seq1 |
| Related Target/Protein | SH3BP5 |
| Region | CDS |
| TargetSeq | CCTTTGAAGATGACAGCTGTA |
| NCBI RefSeq | NM_004844 |
| Alternative Names | SAB; SH3BP-5 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Acute Liver Failure |