shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(Tcte1-shRNA-Seq1)(CAT#: AdV-SI2747WQ)

This product is a Tcte1-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The protein encoded by Tcte1 gene may play a role in the assembly of N-DRC and be required for sperm motility. The expression of Tcte1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype AdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Modification ΔE1/E3
Insert Tcte1-shRNA-Seq1
Related Target/Protein Tcte1
Region CDS
TargetSeq CCTCACCCACTAACAACTGTA
NCBI RefSeq NM_013688
Alternative Names DRC5; D6S46; FAP155
Titer >1*10^10 GC/mL
Related Diseases Infertility
Target Gene
Gene ID 202500
Uniprot ID Q5JU00

Related Products