shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(TCTN3-shRNA-Seq1)(CAT#: AdV-SI3093WQ)
This product is a TCTN3-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The TCTN3 gene encodes a member of the tectonic gene family which functions in Hedgehog signal transduction and development of the neural tube. Mutations in this gene have been associated with Orofaciodigital Syndrome IV and Joubert Syndrom 18. The expression of TCTN3-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Adenoviridae |
Species | Adenovirus |
Serotype | AdV-5 |
Backbone | AdV-5 (ΔE1/E3) |
Tropism | Both nondividing and dividing cells |
Modification | ΔE1/E3 |
Insert | TCTN3-shRNA-Seq1 |
Related Target/Protein | TCTN3 |
Region | CDS |
TargetSeq | CATACCAGTTTCCCTGGAGAT |
NCBI RefSeq | NM_015631 |
Alternative Names | OFD4; TECT3; JBTS18; C10orf61 |
Titer | >1*10^10 GC/mL |
Related Diseases | Orofaciodigital Syndrome IV and Joubert Syndrom 18 |