shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(TEX13B-shRNA-Seq1)(CAT#: AdV-SI0770WQ)
This product is a TEX13B-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. TEX13B is spermatogonially-expressed, germ-cell-specific genes. The expression of TEX13B-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Adenoviridae |
| Species | Adenovirus |
| Serotype | HAdV-5 |
| Backbone | AdV-5 (ΔE1/E3) |
| Tropism | Both nondividing and dividing cells |
| Insert | TEX13B-shRNA-Seq1 |
| Related Target/Protein | TEX13B |
| Region | CDS |
| TargetSeq | CAGGTCAGTACAAACAGCCAT |
| NCBI RefSeq | NM_031273 |
| Alternative Names | TGC3B; TSGA5 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Testis cancer |