shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(TEX13B-shRNA-Seq1)(CAT#: AdV-SI0770WQ)

This product is a TEX13B-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. TEX13B is spermatogonially-expressed, germ-cell-specific genes. The expression of TEX13B-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype HAdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Insert TEX13B-shRNA-Seq1
Related Target/Protein TEX13B
Region CDS
TargetSeq CAGGTCAGTACAAACAGCCAT
NCBI RefSeq NM_031273
Alternative Names TGC3B; TSGA5
Titer >1*10^10 GC/mL
Related Diseases Testis cancer
Target Gene
Gene ID 56156
Uniprot ID Q9BXU2

Related Products