shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(THOC1-shRNA-Seq4)(CAT#: AdV-SI0533WQ)

This product is a THOC1-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. THOC1, also known as HPR1, is part of the TREX (transcription/export) complex and participate in an apoptotic pathway which is characterized by activation of caspase-6, increases in the expression of BAK1 and BCL2L1 and activation of NF-kappa-B. The expression of THOC1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype HAdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Insert THOC1-shRNA-Seq4
Related Target/Protein THOC1
Region CDS
TargetSeq GTATGTGCAATGATCTCCTAA
NCBI RefSeq NM_005131
Alternative Names P84; HPR1; P84N5
Titer >1*10^10 GC/mL
Related Diseases Lung cancer, Liver cancer, Breast cancer
Target Gene
Gene ID 9984
Uniprot ID Q96FV9

Related Products