shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(TMEM167B-shRNA-Seq2)(CAT#: AdV-SI2355WQ)

This product is a TMEM167B-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The protein encoded by TMEM167B nvolved in the early part of the secretory pathway. The expression of TMEM167B-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype AdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Modification ΔE1/E3
Insert TMEM167B-shRNA-Seq2
Related Target/Protein TMEM167B
Region CDS
TargetSeq GCTTGTGTTGTAATGGCCTTT
NCBI RefSeq NM_020141
Alternative Names AD-020; C1orf119
Titer >1*10^10 GC/mL
Related Diseases Prostate cancer
Target Gene
Gene ID 56900
Uniprot ID Q9NRX6

Related Products