shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(TMEM44-shRNA-Seq1)(CAT#: AdV-SI0966WQ)
This product is a TMEM44-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. TMEM44 gene encodes a protein with seven predicted transmembrane domains with no homology to GPCRs, is expressed in a TRPM5-negative and PKD2L1-negative population that is enriched in the bottom portion of taste buds and may represent developmentally immature taste cells. The expression of TMEM44-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Adenoviridae |
| Species | Adenovirus |
| Serotype | HAdV-5 |
| Backbone | AdV-5 (ΔE1/E3) |
| Tropism | Both nondividing and dividing cells |
| Insert | TMEM44-shRNA-Seq1 |
| Related Target/Protein | TMEM44 |
| Region | CDS |
| TargetSeq | CGCTGCTTCTCTATCTGAGAT |
| NCBI RefSeq | NM_138399 |
| Titer | >1*10^10 GC/mL |