shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(TSR2-shRNA-Seq2)(CAT#: AdV-SI0783WQ)

This product is a TSR2-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. The protein encoded by TSR2 gene appears to repress the transcription of NF-kappaB and may be involved in apoptosis. Defects in this gene are a cause of Diamond-Blackfan anemia. The expression of TSR2-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype HAdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Insert TSR2-shRNA-Seq2
Related Target/Protein TSR2
Region CDS
TargetSeq GATTACTTCATGCGCAATGCT
NCBI RefSeq NM_058163
Alternative Names WGG1; DBA14; DT1P1A10
Titer >1*10^10 GC/mL
Related Diseases Diamond-Blackfan anemia
Target Gene
Gene ID 90121
Uniprot ID Q969E8

Related Products